View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11125_low_13 (Length: 503)
Name: NF11125_low_13
Description: NF11125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11125_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 1e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 48714702 - 48714824
Alignment:
| Q |
17 |
gttattggtcccatgatggcatgcacttcctcattttttatgagatccaaagctgttcatcacaaatttaatgattatgtattctaattgaatcatccgt |
116 |
Q |
| |
|
|||||||| ||||| ||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48714702 |
gttattggccccattatggcttgcactttttcatttttaatgagatccaaagctgttcatcacaaatttaatgattatgtattctaattgaatcatccgt |
48714801 |
T |
 |
| Q |
117 |
attttgtcatctttattatctat |
139 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48714802 |
attttgtcatctttattatctat |
48714824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 48702596 - 48702665
Alignment:
| Q |
17 |
gttattggtcccatgatggcatgcacttcctcattttttatgagatccaaagctgttcatcacaaattta |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48702596 |
gttattggtcccatgatggcatgcacttcctcattttttatgagatccaaagctgttcatcacaaattta |
48702665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 427 - 494
Target Start/End: Original strand, 48714840 - 48714907
Alignment:
| Q |
427 |
atatgtttactccccaacccacccaataagtgaaagagaaatgaaatgggagacttgtattgtctgtg |
494 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48714840 |
atatgtttactccccaacccacccaataagagaaagagaaatgaaatgggagacttgtattgtgtgtg |
48714907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University