View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11125_low_41 (Length: 231)
Name: NF11125_low_41
Description: NF11125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11125_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 77 - 209
Target Start/End: Original strand, 8138142 - 8138287
Alignment:
| Q |
77 |
gttggtttttgagatttcaaccaccatcgagaatgaagcttaaatcc------------gatcaagaaacaatcgtttgttgnnnnnnnn-tacgagagt |
163 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
8138142 |
gttggtttttgacatttcaaccaccaccgagaatgaagcttaaatcctatcaaacaaatgatcaagaaacaatcgtttgttgaaaaaaaaatacgagagt |
8138241 |
T |
 |
| Q |
164 |
tttgcgccttccaaatgaccatgatagaggaccttgatgttatgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8138242 |
tttgcgccttccaaatgaccatgatagaggaccttgatgttatgtt |
8138287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University