View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_high_10 (Length: 355)
Name: NF11126_high_10
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 48 - 341
Target Start/End: Complemental strand, 35365310 - 35365020
Alignment:
| Q |
48 |
ttagttagcatgaccgattaaattagtatttgattcttatgaggatgttgtttaattaacgtacgggtgcagaaattttatgatttgggaggtcgtaatg |
147 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35365310 |
ttagttagcatgaccgattaaattaatatttgattcttatgaggatgtt---taattaacgtacgggtgcagaaattttatgatttgggaggtcgtaatg |
35365214 |
T |
 |
| Q |
148 |
ttcttgtaatgggcatgggaccaatgggatgttgtattcctatagagttacctttatggagtaataacggtgattgtgatgttgaactcgtgagtgctgc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35365213 |
ttcttgtaatgggcatgggaccaatgggatgttgtattcctatagagttacctttatggagtaataacggtgattgtgatgttgaactcgtgagtgctgc |
35365114 |
T |
 |
| Q |
248 |
ctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacacagagattggtgctgatgtcttcattgctattactgcacacaaactg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35365113 |
ctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacacagagattggtgctgatgtcttcattgctattactgcacataaactg |
35365020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 112 - 323
Target Start/End: Complemental strand, 35376790 - 35376582
Alignment:
| Q |
112 |
gggtgcagaaattttatgatttgggaggtcgtaatgttcttgtaatgggcatgggaccaatgggatgttgtattcctatagagttacctttatggagtaa |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||| ||||| |||||||||||| ||| ||| ||| ||||||| |||| | |||| |
|
|
| T |
35376790 |
gggtgcagaaactttatgatttgggaggtcgtaaggttcttgtaacgggcacgggaccaatggggtgt-gta--cctgcagagttagctttgagaagtag |
35376694 |
T |
 |
| Q |
212 |
taacggtgattgtgatgttgaactcgtgagtgctgcctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacacagagattggtgctgat |
311 |
Q |
| |
|
|| |||||||||||||| ||||||||||| |||||||| |||||| ||| |||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35376693 |
aaatggtgattgtgatgtggaactcgtgagagctgcctccttatataatccacaacttgtcgaaatgatcaaagaactcaacacagagattggttctgat |
35376594 |
T |
 |
| Q |
312 |
gtcttcattgct |
323 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35376593 |
gtcttcattgct |
35376582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 216 - 334
Target Start/End: Complemental strand, 35358111 - 35357993
Alignment:
| Q |
216 |
ggtgattgtgatgttgaactcgtgagtgctgcctctttatatgatcgacaatttgtcgaaatgatcaaagaactcaacacagagattggtgctgatgtct |
315 |
Q |
| |
|
||||||||||||| |||||| |||| ||||| || |||||| ||| |||| |||| ||||||||| | ||||||||| ||||||||||| |||||||| |
|
|
| T |
35358111 |
ggtgattgtgatgcggaactcatgagagctgcgtccttatataatccacaacttgttcaaatgatcacacaactcaacagagagattggtgatgatgtct |
35358012 |
T |
 |
| Q |
316 |
tcattgctattactgcaca |
334 |
Q |
| |
|
|||||||| ||| |||||| |
|
|
| T |
35358011 |
tcattgctgttaatgcaca |
35357993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University