View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_high_18 (Length: 251)
Name: NF11126_high_18
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 25915023 - 25914808
Alignment:
| Q |
1 |
tttacagccttgttggtttaatttataatactagaaatagattgtgggattgcttaaccgattcagttgtttgaaatcaaattttttcccaaattannnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25915023 |
tttacagccttgttggtttaatttataatactagaaatagattgtgggattgcttaaccgattcagttgtttgaaatcaaattttttcccaaattatttt |
25914924 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnn-cttcaatttcattgctgttacgtagtattcaattgattttcttcgatttttgtgtgaattggatgctttagtcgttttggttca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25914923 |
tttgcattttttttttcttcaatttcattgctgttacgtagtattcaattgattttcttcgatttttgtgtgaattggatgctttagtcgttttggttca |
25914824 |
T |
 |
| Q |
200 |
tgcgtaaactctgtta |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25914823 |
tgcgtaaactctgtta |
25914808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University