View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_low_14 (Length: 294)
Name: NF11126_low_14
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 82 - 284
Target Start/End: Complemental strand, 17592257 - 17592051
Alignment:
| Q |
82 |
tattgctgtttaacttttgcaccttaatttcatgtcttgcttgttttggttgttgtccaattctgggagcatggcttctggttctgtcttgctcagtttg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17592257 |
tattgctgtttaacttttgcaccttaatttcatgtcttgcttgttttggttgttgtccaattctgggagcatgacttctggttctgtcttgctcagtttg |
17592158 |
T |
|
| Q |
182 |
gtttggggtttctcctc---ggtggttccc-ttgctcgtggtttatttttctggttctttgcttgctgtggttcttacctttctcttgtaatgttactct |
277 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17592157 |
gtttggggtttctcctcgttggtggttccctttgctcgtggtttgtttttctggttctttgcttgttgtggttcttacctttctcttgtaatgttactct |
17592058 |
T |
|
| Q |
278 |
ttctctg |
284 |
Q |
| |
|
||||||| |
|
|
| T |
17592057 |
ttctctg |
17592051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 201 - 280
Target Start/End: Complemental strand, 17698488 - 17698409
Alignment:
| Q |
201 |
tggttcccttgctcgtggtttatttttctggttctttgcttgctgtggttcttacctttctcttgtaatgttactctttc |
280 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17698488 |
tggttacctggctcctggtttatttttctggttctttgcttgttgtggttcttacctttctcttgttttgttactctttc |
17698409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University