View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_low_17 (Length: 264)
Name: NF11126_low_17
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 246
Target Start/End: Complemental strand, 14453106 - 14452873
Alignment:
| Q |
13 |
agcagagataaataagtgtctttattcttaaatcattgatgcatgtgttttagcattatgatcatagctgtgactgtgaaggccatgactgcttaattct |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14453106 |
agcaaagataaataagtgtctttattcttaaatcattgatgcatgtgttttagcattatgatcatagctgtgactgtgaaggccatgactgcttaattct |
14453007 |
T |
|
| Q |
113 |
ttagaggtataagggcagtaagagcagtccaatgtttgctaattcgggcgacaggacctaacatggtgccatttgatgatgatcctggggtaaaagagac |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14453006 |
ttagaggtacaagggcagtaagagcagtccaatgtttgctaattcgggcgacaggacctaacatggtgccatttgatgatgatcctggggtaaaagagac |
14452907 |
T |
|
| Q |
213 |
agctacatagtaatctcctttgaaaatgtaggct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14452906 |
agctacatagtaatctcctttgaaaatgtaggct |
14452873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University