View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_low_18 (Length: 253)
Name: NF11126_low_18
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 2518041 - 2517800
Alignment:
| Q |
12 |
gagaagaacatacattgtagtgatagaagtagccgtcattcttgctcaggccaactcgaaaatggttcgctaagagttgtatcttggctccctcggatcc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2518041 |
gagaagaacatacattgtagtgatagaagtagccgtcattcttgctcaggccaactcgaaaatggttcgctaagagttgtatcttggctcccttggatcc |
2517942 |
T |
 |
| Q |
112 |
aagacctctcctggccatgggcacatggtttgaattcaatgtctttctcatttcctcattgttcaatgagtattccatttcttagatcctgctgaaaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517941 |
aagacctctcctggccatgggcacatggtttgaattcaatgtctttctcatttcctcattgttcaatgagtattccatttcttagatcctgctgaaaata |
2517842 |
T |
 |
| Q |
212 |
agatcaaaattttgggtattcttgtcactagaaagcgattaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517841 |
agatcaaaattttgggtattcttgtcactagaaagcgattaa |
2517800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University