View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11126_low_19 (Length: 251)

Name: NF11126_low_19
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11126_low_19
NF11126_low_19
[»] chr3 (1 HSPs)
chr3 (1-215)||(25914808-25915023)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 25915023 - 25914808
Alignment:
1 tttacagccttgttggtttaatttataatactagaaatagattgtgggattgcttaaccgattcagttgtttgaaatcaaattttttcccaaattannnn 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
25915023 tttacagccttgttggtttaatttataatactagaaatagattgtgggattgcttaaccgattcagttgtttgaaatcaaattttttcccaaattatttt 25914924  T
101 nnnnnnnnnnnnnnn-cttcaatttcattgctgttacgtagtattcaattgattttcttcgatttttgtgtgaattggatgctttagtcgttttggttca 199  Q
                    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25914923 tttgcattttttttttcttcaatttcattgctgttacgtagtattcaattgattttcttcgatttttgtgtgaattggatgctttagtcgttttggttca 25914824  T
200 tgcgtaaactctgtta 215  Q
    ||||||||||||||||    
25914823 tgcgtaaactctgtta 25914808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University