View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_low_21 (Length: 242)
Name: NF11126_low_21
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 96 - 237
Target Start/End: Complemental strand, 32117551 - 32117402
Alignment:
| Q |
96 |
taaatttattttcttagcgattgttttaagaa--------tggatttcctaaaattgaatagtagttgaatggaaggataattctatttannnnnnnnnn |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32117551 |
taaatttattttcttagcgattgttttaaggacattcatttgcatttcctaaaattgaatagtagttgaatggaaggataattctgtttatttttttcct |
32117452 |
T |
 |
| Q |
188 |
nnnnatgttgatcttcttcttagctagtcatgcctattcaatcatgcttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32117451 |
ttttatgttgatcttcttcttagctagtcatgcctattcaatcatgcttc |
32117402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 32118743 - 32118651
Alignment:
| Q |
1 |
agcttatttttcttttgactaattcaggtttttctttttgaaaggtaattcaagcttattttgttaggnnnnnnncataatcttatttcattagataa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32118743 |
agcttatttttcttttgactaattcaggtttttc-----gaaaggcaattcaagcttattttgttaggaaaaaaacataatcttatttcattagataa |
32118651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University