View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_low_24 (Length: 237)
Name: NF11126_low_24
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 79 - 222
Target Start/End: Original strand, 32118953 - 32119096
Alignment:
| Q |
79 |
gtcatcgttttattaatatagttggcatggctccactaagtgccataatttgtatccactagtcaagcaaaattggtaagatgcaggaaaaagaccccaa |
178 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32118953 |
gtcatcattttattaatatagttggcatggctccactaagtgccataatttgtatccactagtcaagcaaaattggtaagatgcaggaaaaagaccccaa |
32119052 |
T |
|
| Q |
179 |
aaatttaagttcaacttgttattataaacactcaatattcattg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32119053 |
aaatttaagttcaacttgttattataaacactcaatattcattg |
32119096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 32118890 - 32118921
Alignment:
| Q |
1 |
agctctctctgttacccaacaatgaatagtag |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32118890 |
agctctctctgttacccaacaatgaatagtag |
32118921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University