View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11126_low_25 (Length: 230)
Name: NF11126_low_25
Description: NF11126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11126_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 31836158 - 31835931
Alignment:
| Q |
1 |
tctaaccaggcagcttgacaagctgcaagagatccttatgatgatcaccttttcg---------------tgtcagtggtgatcattcatcttcttttca |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31836158 |
tctaaccaggcagcttgacaagctgcaagagatccttatgatgatcaccttttcgatcttatcttcctcgtgtcagtggtgatcattcatcttcttttca |
31836059 |
T |
 |
| Q |
86 |
atcacttagtatgttttcaatttctttcttggtttttggtttgtatttctaaaatgactcttgtaaaatgcttgaaaaattgaactctataaggtatttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31836058 |
atcacttagtatgttttcaatttctttcttggtttttggtttgtgtttctagaatgactcttgtaaattgcttgaaaaattgaactctataaggtatttt |
31835959 |
T |
 |
| Q |
186 |
ctattcttgagtttgttggttaacatct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31835958 |
ctattcttgagtttgttggttaacatct |
31835931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University