View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11127_high_24 (Length: 331)
Name: NF11127_high_24
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11127_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 320
Target Start/End: Original strand, 52874455 - 52874757
Alignment:
| Q |
18 |
gtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagacttaactgctcgtgatcagcttgatgaacgctataatgaattatctcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874455 |
gtttgtggttgatgtctgtcggaacagttatatgtgcttcgttatggtcagacttaactgctcgtgatcagcttgatgaacgctataatgaattatctcc |
52874554 |
T |
|
| Q |
118 |
caaggttttttcatgtaaccttatatttgtactagtttatgatagtttcttaaatatgttatggagtgacttttaaatcatttggtatatcatgatgtaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874555 |
caaggttttttcatgtaaccttatatttgtactagtttatgatagtttcttaaatatgttatggagtgacttttaaatcatttggtatatcatgatgtaa |
52874654 |
T |
|
| Q |
218 |
agttacactttcatttaactagtgttttaacgatgcttaaattggaaatttataatcaatgaattacctcatcatgaatgctactatgcctttcctttca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874655 |
agttacactttcatttaactagtgttttaacgatgcttaaattggaaatttataatcaatgaattacctcatcatgaatgctactatgcctttcctttca |
52874754 |
T |
|
| Q |
318 |
tct |
320 |
Q |
| |
|
||| |
|
|
| T |
52874755 |
tct |
52874757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University