View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11127_high_34 (Length: 269)

Name: NF11127_high_34
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11127_high_34
NF11127_high_34
[»] chr1 (1 HSPs)
chr1 (11-210)||(8456530-8456726)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 11 - 210
Target Start/End: Complemental strand, 8456726 - 8456530
Alignment:
11 acagatgaggcagtaatagcaacatcaacaatattatgtatgattactatggaacaaccttgtcttgaacannnnnnnnnnnnnnnnnnnattatcatat 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                   ||||||||||    
8456726 acagatgaggcagtaatagcaacatcaacaatattatgtatgattactatggaacaaccttgtcttgaacattcttcttcttcttct---attatcatat 8456630  T
111 taaggaggtatgacaacatgagaatttacctgaaaaagtatttcctttccatctcgcaaaactgcagctggctcttggtgtgaagaaagattgatgactt 210  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||    
8456629 taaggaggtatgacaacatgagactttacctgaaaaagtatttcctttccatctcgcaaaactgcatctggcccttggtgtgaagaaagattgatgactt 8456530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University