View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11127_high_37 (Length: 250)
Name: NF11127_high_37
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11127_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 13381259 - 13381386
Alignment:
| Q |
1 |
tttaatgaccgcaccgtagaagtgccctttattttattcaaaacgtatcttgatttgtacttgtattaattagtgtattttggtaattttgttaaataga |
100 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13381259 |
tttactgaccgcaccgtagaattgccctttattttattcaaaacgtatcttgatttgtacttgtattaattagtgtattttggtaattttgttaaataga |
13381358 |
T |
|
| Q |
101 |
ttttataaagtagaggttttttgacccc |
128 |
Q |
| |
|
|||| | ||||||||||||||||||||| |
|
|
| T |
13381359 |
ttttttcaagtagaggttttttgacccc |
13381386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 137 - 241
Target Start/End: Original strand, 13381417 - 13381521
Alignment:
| Q |
137 |
tattagttgtacatacatattttgatcttcttctcatatttgaatgcaagatgaacggattaggaaatgtggctgaagtaaggctgagagcatcccactt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13381417 |
tattagttgtacatacatattttgatcttcttctcatatttgaatgcaagatgaacggattaggaaatgtggctgaagtaaggctgagagcatcccactt |
13381516 |
T |
|
| Q |
237 |
cttct |
241 |
Q |
| |
|
||||| |
|
|
| T |
13381517 |
cttct |
13381521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University