View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11127_high_42 (Length: 241)

Name: NF11127_high_42
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11127_high_42
NF11127_high_42
[»] chr7 (1 HSPs)
chr7 (1-223)||(44670452-44670674)


Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44670674 - 44670452
Alignment:
1 ccatcgaagtcctttcttgagtgtagctttaactttcccttccacgctgtgaactttatacttggctatccttttcttcctctttgcttctggatcgttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44670674 ccatcgaagtcctttcttgagtgtagctttaactttcccttccacgctgtgaactttatacttggctatccttttcttcctctttgcttctggatcgttg 44670575  T
101 aatctccatggcttttcattcccctgagttgaatttgctgaccgagttccaccggaaccgtagcctttcccgctcatcactacatccacccttctattgc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
44670574 aatctccatggcttttcattcccctgagttgaatttgctgaccgagttccactggaaccgtagcctttcccgctcatcactacatccacccttctattgc 44670475  T
201 cgtcgtaggatggatgacccgac 223  Q
    |||||||||||||||||||||||    
44670474 cgtcgtaggatggatgacccgac 44670452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University