View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11127_low_32 (Length: 287)
Name: NF11127_low_32
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11127_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 270
Target Start/End: Original strand, 47371386 - 47371646
Alignment:
| Q |
8 |
tttttaaacttcaacaaatgatgctgatcttgttcgacatcgcatattaggacgtgagtcgagttatttaccttgatattggcaagggtttcattcgtca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47371386 |
tttttaaacttcaacaaatgatgctgatcttgttcgacatcacatattaggacgtgagtcgagttatttaccttgatattggcaagggtttcattcgtca |
47371485 |
T |
 |
| Q |
108 |
catatgccttgagttgctcttagtttcaagtactaacaactttcttgtcnnnnnnnnnnnngtactaactcttacatcattcacgaacaatacataacat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47371486 |
catatgccttgagttgctcttagtttcaagtactaacaactttcttgtc--aaaaaaaaaagtactaactcttacatcattcacgaacaatacataacat |
47371583 |
T |
 |
| Q |
208 |
atataacgaaactggaattggtttcagatctttctgtctgcatgcacaggagggacctcatat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47371584 |
atataacgaaactggaattggtttcagatctttttgtctgcatgcacaggagggacctcatat |
47371646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University