View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11127_low_35 (Length: 269)
Name: NF11127_low_35
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11127_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 11 - 210
Target Start/End: Complemental strand, 8456726 - 8456530
Alignment:
| Q |
11 |
acagatgaggcagtaatagcaacatcaacaatattatgtatgattactatggaacaaccttgtcttgaacannnnnnnnnnnnnnnnnnnattatcatat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8456726 |
acagatgaggcagtaatagcaacatcaacaatattatgtatgattactatggaacaaccttgtcttgaacattcttcttcttcttct---attatcatat |
8456630 |
T |
 |
| Q |
111 |
taaggaggtatgacaacatgagaatttacctgaaaaagtatttcctttccatctcgcaaaactgcagctggctcttggtgtgaagaaagattgatgactt |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
8456629 |
taaggaggtatgacaacatgagactttacctgaaaaagtatttcctttccatctcgcaaaactgcatctggcccttggtgtgaagaaagattgatgactt |
8456530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University