View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11127_low_44 (Length: 241)
Name: NF11127_low_44
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11127_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 55560627 - 55560842
Alignment:
| Q |
19 |
acaatgacaaatgaatttaaaacatgtgtgagtatgtgactcaaagaaaatagatacgcaatttggctagctaattattataatattcattagagttcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55560627 |
acaatgacaaatgaatttaaaacatgtgtgagtatgtgactcaaagaaaatagatacgcaatttggctagctaattattataatattcattagagttcgt |
55560726 |
T |
 |
| Q |
119 |
atgatgttagatttcaagaggttcctatcgtgaaactccaagatctcctctttgataacatgtcaaaagcctgta---ttaagaatatagtgtagtcttg |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
55560727 |
atgatgttagatttctagaggttcctatcgtgaaactccaagatctcctctttgataacatgtcaaaagcttgtatttttaagaatatagtgtagtcttg |
55560826 |
T |
 |
| Q |
216 |
tagttttcttctctct |
231 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
55560827 |
tagttttcttttctct |
55560842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University