View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11128_low_6 (Length: 313)
Name: NF11128_low_6
Description: NF11128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11128_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 45459764 - 45460060
Alignment:
| Q |
1 |
accagtgccagttgcagcaccagttatagttccagtgcctatgcctgtggtatcgccagttccagtagtttcaccggtgccaatagctactccagtttcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45459764 |
accagtgccagttgcagcaccagttatagttccagtgcctatgcctgtggtatcgccagttccagtagtttcaccggtgccaatagctactccagttccg |
45459863 |
T |
|
| Q |
101 |
gtaccagtaaagtccccagtgccggtagcagctccagctccagtagccgtaccagctgcagctccagctccagtagacgtaccagatgaagctccagctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45459864 |
gtaccagtaaagtccccagtgccggtagcagctccagctccagtagccgtaccagctgcagctccagctccagtagccgtaccagttgaagctccagctc |
45459963 |
T |
|
| Q |
201 |
cagggccggcaatatcacctgtggaagctccagcaccagtattatctcctacaaatccagatgaagctgcagatggtcccaattcaggggtgataaa |
297 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459964 |
cagggccggcaatatcacctgtggaaactccagcaccagtattatctcctacaaatccagatgaagctgcagatggtcccaattcaggggtgataaa |
45460060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University