View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11129_high_14 (Length: 309)
Name: NF11129_high_14
Description: NF11129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11129_high_14 |
 |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0332 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 5 - 299
Target Start/End: Original strand, 5995 - 6291
Alignment:
| Q |
5 |
tgctacactctaggcccgactttgtagattgagtatttccatgtgtaacttggagactaatcccatgccgagtaggatcacataggcaataaaaccatcc |
104 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
5995 |
tgctacactctaggcccgactctgtagattgagtatttccatgtgtaacttggagactaatcccaggccgagtaggatcacataggcgataaaaccatcc |
6094 |
T |
 |
| Q |
105 |
ctcaatagttttaatgtgtgtttctagggtcacagtttgtattttatgcacagactgcacctacacgatcattgctttctatggattcactttgcactat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6095 |
ctcaatagttttaatgtgtgtttctagggtcacagttcgtattttatgcacagactgcacctacacgatcattgctttctatggattcactttgcactat |
6194 |
T |
 |
| Q |
205 |
act--tagatagcagaaaatgattccccctgttattatatcagtccaagaaagaatatggacagtcattttcttctattgaattttcattccctttg |
299 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6195 |
acttatagatagcagaaaatgattccccctgttattatatcagtccaagaaagaatatggacagtcattttcttctattgaattttcattccctttg |
6291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University