View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11129_high_9 (Length: 402)
Name: NF11129_high_9
Description: NF11129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11129_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 155 - 277
Target Start/End: Original strand, 34583875 - 34583997
Alignment:
| Q |
155 |
gctagtgtggattttctcgtaaaatggggctctagtgtaacgatatcaagtagaagttgttgaatactcccctaatgatttgaagaccattctcctcggt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34583875 |
gctagtgtggattttctcgtaaaatggggctctagtgtaacgatatcaagtagaagttgttgaatactcccctaatgatttgaagaccattctcctcggt |
34583974 |
T |
 |
| Q |
255 |
ggttccttgaggacccttgctcc |
277 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34583975 |
ggttccttgaggacccttgctcc |
34583997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 34583543 - 34583663
Alignment:
| Q |
18 |
ataaatgttgatggtagttgtagcggtcattctggccatgctggagctgggg-tctgattaggcgtggtgatggcagctgggttgtcgagttcagcagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34583543 |
ataaatgttgatggtagttgtagcggtcattctggccatgctggagctgggggtctgattaggcgtggtgatggcagctgggttgtcgggttcagcagtt |
34583642 |
T |
 |
| Q |
117 |
acctaggactttccaataaca |
137 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34583643 |
acctaggactttccaataaca |
34583663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 343 - 385
Target Start/End: Original strand, 34584341 - 34584383
Alignment:
| Q |
343 |
attgtagaatgttctaaaatttcttgaatgctctttctgtttc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34584341 |
attgtagaatgttctaaaatttcttgaatgctctttttgtttc |
34584383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 158
Target Start/End: Complemental strand, 13753344 - 13753203
Alignment:
| Q |
19 |
taaatgttgatggtagttgtagcggtcattctggccatgctggagctgggg-tctgattaggcgtggtgatggcagctgggttgtcgag-ttcagcagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | | ||||||||||||| | ||||||| | ||||||||||||||||||| | || |||||||| | |
|
|
| T |
13753344 |
taaatgttgatggtagttgtagcggtaattcttgtcgggctggagctgggggtatgattagacatggtgatggcagctgggtttttcaggttcagcagct |
13753245 |
T |
 |
| Q |
117 |
acctaggactttccaataacaactatgcagaaatcatggcta |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
13753244 |
acctaggactttccaataacacctatgcagaaatcattgcta |
13753203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 155 - 226
Target Start/End: Complemental strand, 13753005 - 13752936
Alignment:
| Q |
155 |
gctagtgtggattttctcgtaaaatggggctctagtgtaacgatatcaagtagaagttgttgaatactcccc |
226 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||| ||||||| ||||||| ||||||| |||||| |||| |
|
|
| T |
13753005 |
gctagtgcggattttctcgcaaagtggggctcta--gtaacgacatcaagtggaagttgcggaatacccccc |
13752936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University