View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11129_low_18 (Length: 241)
Name: NF11129_low_18
Description: NF11129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11129_low_18 |
 | |
|
| [»] scaffold0332 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0332 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 5982 - 5774
Alignment:
| Q |
1 |
catatgactccaaaataccttaccctaatgaaagccggttaagcttaaaattaaaagtactacaaactaacaatgaggaactgaagaagagctaaaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982 |
catatgactccaaaataccttaccctaatgaaagccggttaagcttaaaattaaaagtactacaaactaacaatgaggaactgaagaagagctaaaagct |
5883 |
T |
|
| Q |
101 |
gactgttatcaggtaaccttgcaagtaccatgcaaatttgaaaacagcttttttgaaacaatctatggaatccaacatgcaaaatcaatcacagaaccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5882 |
gactgttatcaggtaaccttgcaagtaccatgcaaatttgaaaacagcgtttttgaaacaatctatggaatccaacatgcaaaatcaatcacagaaccaa |
5783 |
T |
|
| Q |
201 |
aacttaaaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
5782 |
aacttaaaa |
5774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University