View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11129_low_18 (Length: 241)

Name: NF11129_low_18
Description: NF11129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11129_low_18
NF11129_low_18
[»] scaffold0332 (1 HSPs)
scaffold0332 (1-209)||(5774-5982)


Alignment Details
Target: scaffold0332 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0332
Description:

Target: scaffold0332; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 5982 - 5774
Alignment:
1 catatgactccaaaataccttaccctaatgaaagccggttaagcttaaaattaaaagtactacaaactaacaatgaggaactgaagaagagctaaaagct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5982 catatgactccaaaataccttaccctaatgaaagccggttaagcttaaaattaaaagtactacaaactaacaatgaggaactgaagaagagctaaaagct 5883  T
101 gactgttatcaggtaaccttgcaagtaccatgcaaatttgaaaacagcttttttgaaacaatctatggaatccaacatgcaaaatcaatcacagaaccaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
5882 gactgttatcaggtaaccttgcaagtaccatgcaaatttgaaaacagcgtttttgaaacaatctatggaatccaacatgcaaaatcaatcacagaaccaa 5783  T
201 aacttaaaa 209  Q
    |||||||||    
5782 aacttaaaa 5774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University