View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11130_high_2 (Length: 329)
Name: NF11130_high_2
Description: NF11130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11130_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 10 - 315
Target Start/End: Original strand, 5106292 - 5106597
Alignment:
| Q |
10 |
gcacagatatcctcgccggattcaccatcaaagatttcaagtacatatggtttgagtttctccaatgactcaaacatgtctaatagtttgaacagttttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106292 |
gcacagatatcctcgccggattcaccatcaaagatttcaagtacatatggtttgagtttctccaatgactcaaacatgtctaatagtttgaacagttttt |
5106391 |
T |
 |
| Q |
110 |
gtggctctttgttacttctggcgacaccttctccgaatcgaaagaacacggccatgatcttgtctgatattttcacaaagcattctggatggattagccc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106392 |
gtggctctttgttacttctggcgacaccttctccgaatcgaaagaacacggccatgatcttgtctgatattttcacaaagcattctggatggattagccc |
5106491 |
T |
 |
| Q |
210 |
atctatgatttcgcctagaacactttcgcaaagtttcttttctgataaaagaactttctttgttgcaacttcaaagtgttgtgtccaaagggttattgat |
309 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106492 |
atctatgatttcgcctagaacgctttcgcaaagtttcttttctgataaaagaactttctttgttgcaacttcaaagtgttgtgtccaaagggttattgat |
5106591 |
T |
 |
| Q |
310 |
gtttct |
315 |
Q |
| |
|
|||||| |
|
|
| T |
5106592 |
gtttct |
5106597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University