View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11131_high_13 (Length: 350)
Name: NF11131_high_13
Description: NF11131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11131_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 7950164 - 7950393
Alignment:
| Q |
13 |
gagatagtgagttagcttgagggctcgagcttctattacaagtatcaaatatattaaggatggaagacaaattaatgctggagttaatgctagattgaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7950164 |
gagatagtgagttagcttgagggctccagcttctattacaagtatcaaatatattaaggatggaagacaaatcaatgctggagttaatgctagattgaag |
7950263 |
T |
 |
| Q |
113 |
ccagttccaaagagatagcgaaaaaggacaatggagaatgagatgagctgctgtttcttgcgctttgttgcataaaatacacatggaagggaggcggatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7950264 |
ccagttccaaagagatagcgaaaaaggacaatggagaatgagataagctgctgtttcttgcgctttgttgcataaaatacacatggaagggaggcggcat |
7950363 |
T |
 |
| Q |
213 |
cctctcaaggttagattttcatcggttggt |
242 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |
|
|
| T |
7950364 |
cctctccaggctagattttcatcggttggt |
7950393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University