View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11131_high_20 (Length: 279)
Name: NF11131_high_20
Description: NF11131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11131_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 46002074 - 46001828
Alignment:
| Q |
1 |
taagaatatgaactttcataaagaaattctcttgaatccagaaattggaatagctggtttgttttatagcagtaacagatagaaacaaacatattgagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002074 |
taagaatatgaactttcataaagaaattctcttgaatccagaaattggaatagctggtttgttttatagcagtaacagatagaaacaaacatattgagtt |
46001975 |
T |
 |
| Q |
101 |
tggaagagaaggaactttctcacagtcatagcagaactcaaaggaaaatggtaaagtgtgagaaggaactttctcaaaacatgcaggttaatggtttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46001974 |
tggaagagaaggaactttctcacagtcatagcagaactcaaaggaaaatggtaaagtgtgagaaggaactttctcaaaacat---ggttaatggtttctc |
46001878 |
T |
 |
| Q |
201 |
tcttgtaattttaatttaattcaaatgacaaattaattatatcctctaag |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46001877 |
tcttgtaattttaatttaattcaaatgacaaattaattatatcctctaag |
46001828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University