View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11131_high_7 (Length: 428)
Name: NF11131_high_7
Description: NF11131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11131_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 46817365 - 46817118
Alignment:
| Q |
19 |
gtaatccttctacaataagcactctcttcacaccttgtatgggttttcttacaggtagtagtgctaatggcacctcaccaaccactgaatgttgtggtgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46817365 |
gtaatccttctacaataagcactctcttcacaccttgtatgggttttcttacaggtagtagtgctaatggcacctcaccaaccactgaatgttgtggtgc |
46817266 |
T |
 |
| Q |
119 |
tcttaagtccctaacaagtagtggcatgaattgtttgtgtctccttgtaactgcaagtgttcccttcaaaattccaatcaatagaaccttggctatctct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46817265 |
tcttaagtccctaacaagtagtggcatgaattgtttgtgtctccttgtaactgcaagtgttcccttcaaaattccaatcaatagaaccttggctatctct |
46817166 |
T |
 |
| Q |
219 |
ctcccccgtgcttgtaacatgcctggtgttccagttcaatgcaaaggt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46817165 |
ctcccccgtgcttgtaacatgcctggtgttccagttcaatgcaaaggt |
46817118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 6e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 322 - 410
Target Start/End: Original strand, 3948208 - 3948296
Alignment:
| Q |
322 |
gtaggaatatctaacagaatagtcatgggtggatccttaggataacttgataaagcagattaatcaaaaaatgtattgctatcaaaaaa |
410 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3948208 |
gtaggaatatctgacagaatagtcatgtgtggatccttaggataacttgataaagcagattaatcaaaaaatgtattgctatcaaaaaa |
3948296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 192 - 263
Target Start/End: Complemental strand, 1142602 - 1142531
Alignment:
| Q |
192 |
ccaatcaatagaaccttggctatctctctcccccgtgcttgtaacatgcctggtgttccagttcaatgcaaa |
263 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
1142602 |
ccaatcaatagaaccttagctatctctcttcctcgtgcttgtaacttgcctggtgttccacttcaatgcaaa |
1142531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University