View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11131_low_13 (Length: 352)
Name: NF11131_low_13
Description: NF11131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11131_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 21 - 342
Target Start/End: Original strand, 29676458 - 29676778
Alignment:
| Q |
21 |
actggagagttgtgggcgtctcaagcactcgcaggcaaacctgctggaatcttttggagtactggatttaacgggggaggccaggaactctcagcgtgcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29676458 |
actggagagttgtgggcgtctcaagcactcgcaggcaaacctgctggaatcttttggagtactggatttaacgggggaggccaggaactctcagcgtgag |
29676557 |
T |
|
| Q |
121 |
tatcctctttgatctctatctatcttataaatagtattttcctaatttctactgacatgtggcagaatttcacaaatctgttttccgctacatttttctc |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||| || ||||||||||| |
|
|
| T |
29676558 |
tatcctctttgatccctatctatcttataaatagtattttcctaatttctactgacatgtagcagaatttcatacatctgttttcagc-acatttttctc |
29676656 |
T |
|
| Q |
221 |
aggactatgcaaacgcatgagctcgttagtagtttaatcataaaatgtttggtttattttttatgtatcggtgtctgtatgtggcttatgtttttggcat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29676657 |
aggactatgcaaacgcatgagctcgttagtagtttaatcataaaatatttggtttattttttatgtatcggtgtctgtatgtgccttatgtttttggcat |
29676756 |
T |
|
| Q |
321 |
tagtagtgtcgacgtgtctgtg |
342 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
29676757 |
tagtagtgtcaacgtgtctgtg |
29676778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University