View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11131_low_25 (Length: 250)
Name: NF11131_low_25
Description: NF11131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11131_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 136 - 237
Target Start/End: Complemental strand, 46660478 - 46660378
Alignment:
| Q |
136 |
tttgatgccaataccgaacgttcaaagggttatgttttcgtcaggtttggagatgatagtgaaaggtctaaaagctttgaatgaaatgaatggtgttttc |
235 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46660478 |
tttgatgccaataccggacgttcaaagggttatggtttcgtcaggtttggagatgatggtgaaaggtct-aaagctttgaatgaaatgaatggtgttttc |
46660380 |
T |
 |
| Q |
236 |
tg |
237 |
Q |
| |
|
|| |
|
|
| T |
46660379 |
tg |
46660378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 46660656 - 46660571
Alignment:
| Q |
11 |
cacagagcaaccttttcgccttaactgggcgacatttagcgcaggagatcacaaacgctcagataatgtccctgatctttctattt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46660656 |
cacagagcaaccttttcgccttaactgggcgacatttagcacaggagatcacaaacgttcagataatgtccctgatctttctattt |
46660571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 137
Target Start/End: Complemental strand, 46660535 - 46660497
Alignment:
| Q |
99 |
atgttacttgaaactttttctgataaatacccttcagtt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46660535 |
atgttacttgaaactttttctgataaatacccttcagtt |
46660497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 191
Target Start/End: Original strand, 6174084 - 6174137
Alignment:
| Q |
138 |
tgatgccaataccgaacgttcaaagggttatgttttcgtcaggtttggagatga |
191 |
Q |
| |
|
|||||||||||| | ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
6174084 |
tgatgccaatactggccgttcaaagggctatggattcgtcaggtttggagatga |
6174137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University