View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11131_low_7 (Length: 431)
Name: NF11131_low_7
Description: NF11131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11131_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 21 - 418
Target Start/End: Original strand, 26552612 - 26553018
Alignment:
| Q |
21 |
tttgatctgggacaacgagccatccttttattctttagactgcactttatgggtgaaatacaagttgttggattaggattacgtgtacctatgattacga |
120 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26552612 |
tttgatcagggacaacgagccatccttttattctttagactgcactttatgggtgaaatacaagttgttggattaggattacgtgtacctatgattacga |
26552711 |
T |
|
| Q |
121 |
tattacctatatatccggttaacataaggtgttatccagggctccattctgaaaatatgtatatcggtaaaatgcttgagaccttttttaaagccatgct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26552712 |
tattacctatatatccggttaacataaggtgttatccagggctccattctgagaatatgtatatcggtaaaatgcttgagaccttttttaaagccatgct |
26552811 |
T |
|
| Q |
221 |
ctatca---------gtgcctctaactcgattactttcaaataagggcttttgtcaaggtctttgcaatacattacctgcatagccgtggtgcgcaacgt |
311 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26552812 |
ctatcagtgatgaatgtggctctaactcgattactttcaaataagggcttttgtcaaggtctttgcaatacattacctgcaaagccgtggtgtgcaacgt |
26552911 |
T |
|
| Q |
312 |
agactgttagtttagcatactcttttcnnnnnnnacaagttaaatttagtgtcgaggtgggttgaatttatgcgagtggtagatgccagttggaatttta |
411 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26552912 |
ggactgttagtttagcatactcttttctttttttacaagttaaatttagtgtcgaggtgggttgaatttatgcgagtggtagatgccagttggaatttta |
26553011 |
T |
|
| Q |
412 |
tccgtct |
418 |
Q |
| |
|
||||||| |
|
|
| T |
26553012 |
tccgtct |
26553018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University