View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11132_high_22 (Length: 243)
Name: NF11132_high_22
Description: NF11132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11132_high_22 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 92 - 243
Target Start/End: Original strand, 32176421 - 32176572
Alignment:
| Q |
92 |
tattgttgacattatttttccacttttgaattagcttctgaatggtaacctcacaatctccaccaacacttatagccttccttccttcctctttaagctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32176421 |
tattgttgacattatttttccacttttgaattagcttctgaatggtaacctcacaatctccaccaacacttatagccttccttccttcctctttaagctc |
32176520 |
T |
 |
| Q |
192 |
tattgctttaactttaaacaattcattcttcatcatctcttttatagcatct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32176521 |
tattgctttaactttaaacaattcattcttcatcatctcttttatagcatct |
32176572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 93 - 243
Target Start/End: Original strand, 32183590 - 32183740
Alignment:
| Q |
93 |
attgttgacattatttttccacttttgaattagcttctgaatggtaacctcacaatctccaccaacacttatagccttccttccttcctctttaagctct |
192 |
Q |
| |
|
|||||||||||| |||||||||||| |||| ||||||||||| |||||||||||||| ||||||| || |||||| || ||| | |||||||||||| |
|
|
| T |
32183590 |
attgttgacattgtttttccactttcgaataagcttctgaatagtaacctcacaatccccaccaatgctaatagccctcaatcccccatctttaagctct |
32183689 |
T |
 |
| Q |
193 |
attgctttaactttaaacaattcattcttcatcatctcttttatagcatct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183690 |
attgctttaactttaaacaattcattcttcatcatctcttttatagcatct |
32183740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University