View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11132_low_20 (Length: 252)
Name: NF11132_low_20
Description: NF11132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11132_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 8847267 - 8847044
Alignment:
| Q |
13 |
ttacacacaaatttagttgatgctaataaattatacaggaaataatgtacaatatgatgcttataatgcaacaacaattcatagagaatagaacaacatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8847267 |
ttacacacaaatttagttgatgctaataaattatacaggaaataatgtacaatatgatgcttataatgcaacaacaattcatagagaatagaacaacatg |
8847168 |
T |
 |
| Q |
113 |
caaat-ttgtatcggtacttgatgaagatgtctacttgaagaattccataacccaaaaaccagagagatagcatgcaaatttgatgccactaaatccaga |
211 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8847167 |
caaatgttgtattggtacttgatgaagatgtctacttgaagaattccacaacccaaaaaccagagagatagcatgcaaatttgatgccactaaatccaga |
8847068 |
T |
 |
| Q |
212 |
ttctaatgccaatttcatgaactc |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8847067 |
ttctaatgccaatttcatgaactc |
8847044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University