View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11132_low_21 (Length: 250)

Name: NF11132_low_21
Description: NF11132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11132_low_21
NF11132_low_21
[»] chr7 (2 HSPs)
chr7 (11-106)||(4903868-4903963)
chr7 (201-250)||(4903694-4903743)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 4903963 - 4903868
Alignment:
11 gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagtattctggtttaaactgttgtgtgc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
4903963 gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagaattctggtttaaactgttgtgtgc 4903868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 4903743 - 4903694
Alignment:
201 ttggtacattgaaaacgataaagcctagacatgatagtccctaaatgccc 250  Q
    ||||| || ||||||||||||||| |||||||||||||||||||||||||    
4903743 ttggtgcaatgaaaacgataaagcttagacatgatagtccctaaatgccc 4903694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University