View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11132_low_21 (Length: 250)
Name: NF11132_low_21
Description: NF11132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11132_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 4903963 - 4903868
Alignment:
| Q |
11 |
gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagtattctggtttaaactgttgtgtgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4903963 |
gatgaactccacaacattattggtaatttgttttcttttatttttagaggaagcattgaaattaggtatagaattctggtttaaactgttgtgtgc |
4903868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 4903743 - 4903694
Alignment:
| Q |
201 |
ttggtacattgaaaacgataaagcctagacatgatagtccctaaatgccc |
250 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4903743 |
ttggtgcaatgaaaacgataaagcttagacatgatagtccctaaatgccc |
4903694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University