View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_high_41 (Length: 281)
Name: NF11133_high_41
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 37600111 - 37599879
Alignment:
| Q |
1 |
gtgtcgtagcgttttgctagtgatatccttcgattgccattagaaaaaataattgtgcctcttctccattgtggttgtgttccttaatatattatgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37600111 |
gtgtcgtagcgttttgctagtgatatccttcgattgccattagaaaaaataattgtgcctcttctccattgtggttgtgttccttaat----tatgttgt |
37600016 |
T |
 |
| Q |
101 |
ttttt-gcaacaaattttgcagttatgtctgaataaaccttttggttcttgaaatataaatttccatttagttcgtactttggcctcctgtatgata-an |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37600015 |
ttttttgcaacaaattttgcagttatgtctgaataaaccttttggttcttgaaatataaatttccatttagttcgcactttggcctcctgtatgatattt |
37599916 |
T |
 |
| Q |
199 |
nnnnnnnnaaatcttgttgtcgcagttgtgcaatttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37599915 |
ttttttttaaatcttgttgtcgcagttgtgcaatttt |
37599879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University