View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_high_44 (Length: 271)
Name: NF11133_high_44
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 252
Target Start/End: Original strand, 6119494 - 6119730
Alignment:
| Q |
16 |
atgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgcgcgtaacaatccggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6119494 |
atgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgggcgtaacaatccggttt |
6119593 |
T |
 |
| Q |
116 |
ggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttactgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119594 |
ggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttactgtt |
6119693 |
T |
 |
| Q |
216 |
gtgtgcattgaggctatacctgcgttttggactagaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119694 |
gtgtgcattgaggctatacctgcgttttggactagaa |
6119730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University