View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_high_47 (Length: 250)
Name: NF11133_high_47
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 44965565 - 44965803
Alignment:
| Q |
1 |
ataaggtgaaattctccggcgaggggatgacagtgacggcttcgccgtcgtcttcaccggcggttggctctttgaggaaagagaaacaggggagttttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965565 |
ataaggtgaaattctccggcgaggggatgacagtgacagcttcaccgtcgtcttcaccggcggttggctctttgaggaaagagaaacaggggagttttcc |
44965664 |
T |
|
| Q |
101 |
ggctgggatgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
44965665 |
ggctgggatgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagctagttctccggcgaacaggagtgatgatacgttg |
44965764 |
T |
|
| Q |
201 |
ttgcagcagcatgatggaattcaaagtgctattcttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965765 |
ttgcagcagcatgatggaattcaaagtgctattcttcat |
44965803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 227
Target Start/End: Original strand, 28697958 - 28698056
Alignment:
| Q |
128 |
tttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagcagcatgatggaattcaaagt |
227 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| || |||||||||| | ||||||||| | | |||||||||| |||||||||| |||||| |
|
|
| T |
28697958 |
tttgggtaagagtaggtcgccggataccgtggccggagttggtactccggcgaataagagtgatga-atgttgttgcagcaagatgatggaatccaaagt |
28698056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University