View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_high_48 (Length: 250)
Name: NF11133_high_48
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 30835295 - 30835078
Alignment:
| Q |
17 |
ttcattcatatatcaaacaatttatagtactcaatgatttaaatagagcttgttgaataaataaataaataaatagcattaattcaacgctgactaaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
30835295 |
ttcattcatatatcaaacaatttatagtactcaatgatttaaatagagcttgttgaataaataaataaata----gcattaattcaacgttgactaaaga |
30835200 |
T |
 |
| Q |
117 |
taaggtgatgatagagatagtgtctgtttgaattgacagtaagtttgacaaaattacggtgattttgatgaaaatctaaagtataattttagtttaaatg |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30835199 |
taaggtgaggatagagatagtgtctgtttgaattgacggtaagattgacaaaattacggtgattttgatgaaaatctaaagtataattctagtttaaatg |
30835100 |
T |
 |
| Q |
217 |
gtcatagcccatcgtgatttca |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30835099 |
gtcatagcccatcgtgatttca |
30835078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University