View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_low_44 (Length: 274)
Name: NF11133_low_44
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 31616661 - 31616932
Alignment:
| Q |
1 |
ttggtaagaacaaatgaattatgtcgaagctattcggacgcttgtataaagctatgcaaggaacttggtgtgaaagttgttgatctttttaatgcactgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31616661 |
ttggtaagaacaaatgaattatgtcgaagctattcggacgcttgtataaagctatgcaaggaacttggtgtgaaagttgttgatctttttaatgcactac |
31616760 |
T |
 |
| Q |
101 |
aaagtatagatgattgggagaatgcatgttttacgtaagcttcttaacctctttcttaatcaattttatttttccaaataccaagaaatatcaagtgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31616761 |
aaagtatagatgattgggagaatgcatgttttacgtaagcttcttaacctctttcttaatcaattttatttttccaaataccaagaaatatcaagtgaca |
31616860 |
T |
 |
| Q |
201 |
tactgcaatgtaattgttgaatatccaaatccttcactagcttttctcaaatatcttcttcttctctctcga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
31616861 |
tactgcaatgtaattgttgaatatccaaatccttcactagcttttctcaaatatcttcttgttctttctcga |
31616932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University