View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11133_low_45 (Length: 271)

Name: NF11133_low_45
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11133_low_45
NF11133_low_45
[»] chr4 (1 HSPs)
chr4 (16-252)||(6119494-6119730)


Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 252
Target Start/End: Original strand, 6119494 - 6119730
Alignment:
16 atgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgcgcgtaacaatccggttt 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6119494 atgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgggcgtaacaatccggttt 6119593  T
116 ggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttactgtt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6119594 ggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttactgtt 6119693  T
216 gtgtgcattgaggctatacctgcgttttggactagaa 252  Q
    |||||||||||||||||||||||||||||||||||||    
6119694 gtgtgcattgaggctatacctgcgttttggactagaa 6119730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University