View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_low_51 (Length: 244)
Name: NF11133_low_51
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 44965574 - 44965346
Alignment:
| Q |
1 |
ttcaccttatcaccatacctcttcgaaaccttaacataaagaggcttaatcagcttcaaatatttctgcaaaatctcctttgaaactcgctctgttttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965574 |
ttcaccttatcaccatacctcttcgaaaccttaacataaagaggcttaatcagcttcaaatatttctgcaaaatctcctttgaaactcgctctgttttag |
44965475 |
T |
 |
| Q |
101 |
gttcctctgttccttgattccgaattttgctaccaaagcttctagtgctgttatctctactaagcattggagtagaatgaaaatcttgttcgatgtttag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44965474 |
gttcctctgttccttgattccgaattttgctaccaaagcttcttgtgctgttatctctactaagcattggagtagaatgaaaatcatgttcgatgtttag |
44965375 |
T |
 |
| Q |
201 |
tttcacagaaaaaactttggtttctttct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44965374 |
tttcacagaaaaaactttggtttctttct |
44965346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University