View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_low_56 (Length: 237)
Name: NF11133_low_56
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 41 - 207
Target Start/End: Complemental strand, 7889244 - 7889078
Alignment:
| Q |
41 |
tggtggaacttattctttatttttcatctgaatcttttcttattacaggggaaccatcttagacacaaattagacaacctgataacgatggtaatgatca |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7889244 |
tggtggaacttattctttattttccatctgaatcttttcttatcacaagggaaccaacttagacacaaattagacaacctgataacgatggtaatgatca |
7889145 |
T |
|
| Q |
141 |
acagcaacatccccgttagttccatccaatattgttcctgaaagcaactgcatgtgagagtcgagtg |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7889144 |
acagcaacatccccattagttccatccaatattgttcctgaaagcaactgcatgtgagagtcgagtg |
7889078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University