View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_low_61 (Length: 227)
Name: NF11133_low_61
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 12473955 - 12473740
Alignment:
| Q |
1 |
gtttttagggtttagagaatgtgtccctttaacgatcaaatgtccttaattataaggaagactgtagaattttcctgtcagaataattgattttgttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
12473955 |
gtttttagggtttagagaatgtgtccctttaacgatcatctgtccttaattataaggaagactgtagaattttcctgtcggaatcattgattttgttaga |
12473856 |
T |
 |
| Q |
101 |
ctgtcctcgacgt-------agatcaacatttgatcaccattaccggattctcttgggtgctcccctggggaatctcatagcatactccctagtgagcaa |
193 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12473855 |
ctgtcctcgacgttatttgcatatcaacatttgatcaccattaccggattctcttgggtgctcccctggggaatctcatagcatactccctagtgagcaa |
12473756 |
T |
 |
| Q |
194 |
gtccataagtggattg |
209 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12473755 |
gtccataagtggattg |
12473740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University