View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_low_66 (Length: 219)
Name: NF11133_low_66
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 22226547 - 22226358
Alignment:
| Q |
20 |
gaaaggacactgagtcactattattagtcttgatcatgagtgtnnnnnnnngagtacaccacaatcgagattcctgctggtcactttcctttttcttgct |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22226547 |
gaaaggacactgagtcactattaatagtcttgatcatgagtgtaaaaaaaagagcacaccacaatcgagattcctgctggtcactttcctttttcttgct |
22226448 |
T |
|
| Q |
120 |
agacatgaacacaacacaaaaatccattatctttctttttctctctactttaatcaatacgactttgctgggttgattttgtctctgctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22226447 |
agacatgaacacaacacaaaaatccattatctttctttttctctctactttaatcaatacgactttgctgggttgattttgtctttgctt |
22226358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University