View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11133_low_73 (Length: 203)
Name: NF11133_low_73
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11133_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 6556788 - 6556707
Alignment:
| Q |
1 |
cttttctaaatttaggaacttgcaaatgtttcttaacctcaattaaatacggttgaaatgttaattttacgatcacttatga |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6556788 |
cttttctaaatttaggaacttgcaaatgtttcttaacctcaattaaatacggttgaaatgttaattttacgatcacttatga |
6556707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 186
Target Start/End: Complemental strand, 6556637 - 6556603
Alignment:
| Q |
152 |
cattttatctaggtggcgataatttatataacttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
6556637 |
cattttatctaggtggcgataatttatagaacttg |
6556603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University