View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11134_low_17 (Length: 296)
Name: NF11134_low_17
Description: NF11134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11134_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 277
Target Start/End: Complemental strand, 7153930 - 7153671
Alignment:
| Q |
18 |
taaacatctcgattaccccttatatatgttttaaaatcgacaagtttttacaattcatgtgtatgatggattttattgccttgcagatgcaacagcaggt |
117 |
Q |
| |
|
|||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153930 |
taaatatctcgaataccccttatatatattttaaaatcgacaagtttttacaattcatgtgtatgatggattttattgccttgcagatgcaacagcaggt |
7153831 |
T |
|
| Q |
118 |
ctagtgggttgggctatctcgaaggcgaaaccacagaaaccgtgattctgggcgttgctccggcaaagatccattttgagggtgctgaaatgggtgttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153830 |
ctagtgggttgggctatctcgaaggtgaaaccacagaaaccgtgattatgggcgttgctccggcaaagatccattttgagggtgctgaaatgggtgttgc |
7153731 |
T |
|
| Q |
218 |
agcggaggaaggtggctgcaagtgtggagatagctgcacatgtgacccttgcaactgtaa |
277 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153730 |
agctgaggaaggtggctgcaagtgtggagatagctgcacatgtgacccttgcaactgtaa |
7153671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 100 - 274
Target Start/End: Complemental strand, 7159945 - 7159771
Alignment:
| Q |
100 |
gcagatgcaacagcaggtctagtgggttgggctatctcgaaggcgaaaccacagaaaccgtgattctgggcgttgctccggcaaagatccattttgaggg |
199 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||| |||||||||||||||||||||||||||| ||||||||| |||||| |||||||| || || || |
|
|
| T |
7159945 |
gcagatgcaacaagaggtctagtggattgaactatgccgaaggcgaaaccacagaaaccgtgattttgggcgttggtccggccaagatccaattcgaagg |
7159846 |
T |
|
| Q |
200 |
tgctgaaatgggtgttgcagcggaggaaggtggctgcaagtgtggagatagctgcacatgtgacccttgcaactg |
274 |
Q |
| |
|
||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7159845 |
tgctgaaatgggtgtagcagctgaggatggtggctgcaagtgtggggatagctgcacatgtgacccttgcaactg |
7159771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University