View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11134_low_24 (Length: 231)
Name: NF11134_low_24
Description: NF11134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11134_low_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 48 - 231
Target Start/End: Complemental strand, 39476043 - 39475848
Alignment:
| Q |
48 |
tcttatattggtctgatggtgtggcttgagaccttaga-gtatat----------gtttgagatttgattctcctcaatttaacaaaatgtacttttcta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39476043 |
tcttatattggtctgatggtgtggcttgagaccttaaaagtatatttcttttaatgtttgagatttgattctcctcaatttaacaaaatgtacttttcta |
39475944 |
T |
 |
| Q |
137 |
aaatagaaattcaattcaaatactctttggcgtttgttgagttaa-gggattgattatttggctcatgtaaattgattgattcaatccaaaccaaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475943 |
aaatagaaattcaattcaaatactctttggcgtttgttgagttaaggggattgattatttggctcatgtaaattgattgattcaatccaaaccaaa |
39475848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University