View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11136_high_3 (Length: 224)
Name: NF11136_high_3
Description: NF11136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11136_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 28 - 211
Target Start/End: Complemental strand, 3307871 - 3307688
Alignment:
| Q |
28 |
tacttcatcctcatacaagtctcatcaaaagtaacatcattgctcatcatgacccttaagcctccaggttccatactcaattgaataacttgtaaccctt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3307871 |
tacttcatcctcatacaagtctcatcaaaagtaacatcattgctcatcatgacccttaagcctccaggttccatactcaattcaataacttgtaaccctt |
3307772 |
T |
 |
| Q |
128 |
atgccttcaggataaccaatgaagacacaatcgagagctctaacttcaaacctccacaggtgtcttgaaatttattcatattga |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3307771 |
atgccttctggataaccaatgaagacacaatcgagagctctaacttcaaacctccataggtgtcttgaaatttattcatattga |
3307688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University