View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_high_26 (Length: 378)
Name: NF11137_high_26
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 10 - 361
Target Start/End: Complemental strand, 45098845 - 45098494
Alignment:
| Q |
10 |
gcagagataatgaagatggtcaacgatgttgataatactaatattttccacaggaggaagcatttatgggagttgataggttcaattgctggaggaattg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098845 |
gcagagataatgaagatggtcaacgatgttgataatactaatattttccacaggaggaagcatttatgggagttgataggttcaattgctggaggaattg |
45098746 |
T |
 |
| Q |
110 |
tcatcgcattttttgttgtgactatttttctacttgctaccagatgtaggaagaaaaaatcaaaagaaagtacagtggaaagtgttggatggacgccttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098745 |
tcatcgcattttttgttgtgactatttttctacttgctaccagatgcaggaagagaaaatcaaaagaaagtacagtggaaagtgttggatggacgccttt |
45098646 |
T |
 |
| Q |
210 |
gcgtatgtttggagggagttcccttagtagaacatccgaacatggttcttatggatatcttggaatgaagattccttttgctgaaatacaatcagcaaca |
309 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098645 |
gcgaatgtttggagggagttcccttagtagaacatccgaacatggttcatatggatatcttggaatgaagattccttttgctgaaatacaatcagcaaca |
45098546 |
T |
 |
| Q |
310 |
aacaattttgatagaaatttgattataggctctggtggatttggtatggtct |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098545 |
aacaattttgatagaaatttgattataggctctggtggatttggtatggtct |
45098494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 17349346 - 17349403
Alignment:
| Q |
184 |
gtggaaagtgttggatggacgcctttgcgtatgtttggagggagttcccttagtagaa |
241 |
Q |
| |
|
|||| |||| |||||||||||||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
17349346 |
gtgggaagtattggatggacgcctttacgcatgtttggagggagttctcttagtagaa |
17349403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 241
Target Start/End: Original strand, 17364548 - 17364613
Alignment:
| Q |
176 |
aaagtacagtggaaagtgttggatggacgcctttgcgtatgtttggagggagttcccttagtagaa |
241 |
Q |
| |
|
|||| ||||| | |||||| |||||||||||||| || ||||| |||||||||| |||||||||| |
|
|
| T |
17364548 |
aaaggacagtaggaagtgtaggatggacgcctttacgcgtgtttagagggagttcgcttagtagaa |
17364613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 319
Target Start/End: Complemental strand, 14536955 - 14536919
Alignment:
| Q |
283 |
ccttttgctgaaatacaatcagcaacaaacaattttg |
319 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14536955 |
ccttttgctgaaatacaatcagcaaaaaacaattttg |
14536919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University