View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_high_36 (Length: 294)
Name: NF11137_high_36
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 7174831 - 7175114
Alignment:
| Q |
1 |
taggccataaaccaagttttgtgtggcgcagcatcttcagcgctaagagagtaattcgcgaaggtattcgatggaaaattggaagcggagtgaatatacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7174831 |
taggccataaaccaagttttgtgtggcgcagcatcttcagcgctaagagagtaattcgcgaaggtattcgatggaaaattggaatttgagtgaatatacc |
7174930 |
T |
|
| Q |
101 |
aatatttgatgctccatggctcgaaggtgggaaatgtgtttctggtgaagggcaaaatagcgaggttatccaacatggcaaaattcactcccttatagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7174931 |
aatatttgatgctccatggctcgaaggtgggaaatgtgtttctggtgaagggcaaaatagcgaggttatccaacatgccaaaattcactcccttatagat |
7175030 |
T |
|
| Q |
201 |
cacaacttccggtgttggaaccaagatgttattcattgctactttgataacagtacagcccaacaaatcctaaaaacacctttg |
284 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175031 |
cacaacttacggtgttggaaccaagatgttattcattgctactttgataacagtacagcccaacaaatcctaaaaacacctttg |
7175114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University