View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_high_41 (Length: 258)
Name: NF11137_high_41
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 117 - 248
Target Start/End: Original strand, 14665378 - 14665509
Alignment:
| Q |
117 |
aattggggttaacttgctgctgcgaacttctgtctagtgttgcagcagtcctttgacaccttactgtttgagagcacatgcagacacagtagcaggtgtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14665378 |
aattggggttaacttgctgctgcgaacttctgcccagtgttgcagcagtcctttgacgccttactgtttgagagcacatgcagacacagtagcagatgtc |
14665477 |
T |
|
| Q |
217 |
tctacattataccaaatcttgttgttcctttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14665478 |
tctacattataccaaatcttgttgttcctttg |
14665509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 26 - 105
Target Start/End: Original strand, 14653014 - 14653093
Alignment:
| Q |
26 |
atatgtcaataccaaccttgttgtgaagcttcgaagaggctgcatccacattgcatttgtagcgtcctagatgaggtttt |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | | ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14653014 |
atatgtcagtaccaaccttgttgtgaagctccaataaggctgcatacacattgcatttgtagcgtcctagatgaggtttt |
14653093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 26 - 105
Target Start/End: Original strand, 14662805 - 14662884
Alignment:
| Q |
26 |
atatgtcaataccaaccttgttgtgaagcttcgaagaggctgcatccacattgcatttgtagcgtcctagatgaggtttt |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | | ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14662805 |
atatgtcagtaccaaccttgttgtgaagctccaataaggctgcatacacattgcatttgtagcgtcctagatgaggtttt |
14662884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 14687988 - 14687940
Alignment:
| Q |
42 |
cttgttgtgaagcttcgaagaggctgcatccacattgcatttgtagcgt |
90 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
14687988 |
cttgttgtgaagctccgaaaaggctgcattcacattgcatttgtagcgt |
14687940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 14665343 - 14665378
Alignment:
| Q |
1 |
acattctcaagctgcaaaatcttttatatgtcaata |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14665343 |
acattctcaagctgcaaaatcttttatatgtcaata |
14665378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University