View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11137_low_12 (Length: 475)
Name: NF11137_low_12
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11137_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 231 - 464
Target Start/End: Original strand, 33887493 - 33887720
Alignment:
| Q |
231 |
ctgaagaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaacggtgtagtgtcgagctccttaacgtcatcg |
330 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887493 |
ctgaggaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaacggtgtagtgtcgagctccttaacgtc---- |
33887588 |
T |
|
| Q |
331 |
tcgtcggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatcggagcgaaactcgtcagaagccgacgaaagaatattttctgcag |
430 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33887589 |
--gttggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatccgagcgaaactcgtcggaagccgacgaaagaatattttctgcag |
33887686 |
T |
|
| Q |
431 |
cttcagcgagcgagtttggtagttgatgcttcat |
464 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
33887687 |
cttcagctagcgagtttggtagttgatgcttcat |
33887720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 19 - 164
Target Start/End: Original strand, 33887299 - 33887442
Alignment:
| Q |
19 |
aaattgaacgtgaaaataaagagagaaactgaaacataaaatataaaaattacctgaacgattttaaattgtggttggttttgtctaccgtttcaaaaca |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33887299 |
aaattgaacgtgaaaataaagag--aaactgaaacataaaatataaaaattacctgaacgattttaaattgtggttcgttttgtctaccgtttcaaaaca |
33887396 |
T |
|
| Q |
119 |
cttagttttcagctgcaagatcatcacagtaattcacaaatattag |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887397 |
cttagttttcagctgcaagatcatcacagtaattcacaaatattag |
33887442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University